Journal: Frontiers in Microbiology

Article Title: The antibacterial activity of a photoactivatable diarylacetylene against Gram-positive bacteria

doi: 10.3389/fmicb.2023.1243818

Figure Lengend Snippet: Screening lead compounds for antibacterial activity against Gram-positive and Gram-negative bacteria. Two-fold dilutions of six lead compounds (labelled 1–6) were applied in 6 μL volumes to the surface of a soft agar overlay inoculated with Bacillus subtilis , Staphylococcus epidermidis , Escherichia coli or Pseudomonas fluorescens . The LB agar plates were exposed to light at 365 nm for 5 min and then incubated for 24 h at 37°C prior to imaging. Controls without light activation or with application of DMSO are shown in .

Article Snippet: Bacillus subtilis 168 (ATCC 23857), Staphylococcus epidermidis (ATCC 12228), Pseudomonas fluorescens (ATCC 13525) and Escherichia coli FDA strain Seattle 1946 (ATCC 25922) were obtained from the American Type Culture Collection.

Techniques: Activity Assay, Bacteria, Incubation, Imaging, Activation Assay

Journal: Frontiers in Microbiology

Article Title: The antibacterial activity of a photoactivatable diarylacetylene against Gram-positive bacteria

doi: 10.3389/fmicb.2023.1243818

Figure Lengend Snippet: Effect of Compound 2 on bacterial growth. Escherichia coli (A) , B. subtilis (B) and S. epidermidis (C) were cultivated in LB broth at 37°C in 96-well plates in a plate reader with continuous shaking. Growth was monitored at OD 600nm in samples exposed to light at 365 nm for 5 min (filled symbols) or without light treatment (open symbols). Samples contained 2 μM Compound 2 or 0.2% DMSO indicated by circles or squares, respectively.

Article Snippet: Bacillus subtilis 168 (ATCC 23857), Staphylococcus epidermidis (ATCC 12228), Pseudomonas fluorescens (ATCC 13525) and Escherichia coli FDA strain Seattle 1946 (ATCC 25922) were obtained from the American Type Culture Collection.

Techniques:

Journal: Frontiers in Microbiology

Article Title: The antibacterial activity of a photoactivatable diarylacetylene against Gram-positive bacteria

doi: 10.3389/fmicb.2023.1243818

Figure Lengend Snippet: Real-time monitoring of bacterial membrane integrity. The BacLight assay of membrane integrity following photoactivation of Compound 2 . S. epidermidis (A) , B. subtilis (B) , P. fluorescens (C) and E. coli (D) in mid-log phase of growth were stained with PI (magenta) and SYTO 9 (yellow) and imaged by confocal microscopy without light activation (−) or 10 min after photoactivation with the 405 nm laser (+). The laser was applied at 30% power for 1 min. The bar represents 3 μm.

Article Snippet: Bacillus subtilis 168 (ATCC 23857), Staphylococcus epidermidis (ATCC 12228), Pseudomonas fluorescens (ATCC 13525) and Escherichia coli FDA strain Seattle 1946 (ATCC 25922) were obtained from the American Type Culture Collection.

Techniques: Membrane, BacLight Assay, Staining, Confocal Microscopy, Activation Assay

Journal: Frontiers in Microbiology

Article Title: The antibacterial activity of a photoactivatable diarylacetylene against Gram-positive bacteria

doi: 10.3389/fmicb.2023.1243818

Figure Lengend Snippet: Role of the E. coli outer membrane in protecting against Compound 2 toxicity. (A) The viability of E. coli O + , O − and Δ rfaC cells was evaluated as in with exposure to 2 μM Compound 2 with or without light activation. (B) PI assay of E. coli strains to monitor loss of membrane integrity. (C) Real-time imaging of E. coli strains stained with PI (magenta) and SYTO 9 (yellow) by confocal microscopy. Images taken prior to light exposure (−) and 10 min after photoactivation (+) as indicated. The bar represents 3 μm.

Article Snippet: Bacillus subtilis 168 (ATCC 23857), Staphylococcus epidermidis (ATCC 12228), Pseudomonas fluorescens (ATCC 13525) and Escherichia coli FDA strain Seattle 1946 (ATCC 25922) were obtained from the American Type Culture Collection.

Techniques: Membrane, Activation Assay, Imaging, Staining, Confocal Microscopy

Journal: Frontiers in Microbiology

Article Title: The antibacterial activity of a photoactivatable diarylacetylene against Gram-positive bacteria

doi: 10.3389/fmicb.2023.1243818

Figure Lengend Snippet: Susceptibility of E. coli strains deficient in oxidative damage and tolerance pathways. The viability of bacteria exposed to 2 μM Compound 2 after photoactivation is shown. Serial dilutions of bacteria were applied to LB agar plates and colonies counted to determine CFU/ml. A representative image of each strain is shown (A) and the CFU/ml (B) represents the mean and standard error of three independent experiments.

Article Snippet: Bacillus subtilis 168 (ATCC 23857), Staphylococcus epidermidis (ATCC 12228), Pseudomonas fluorescens (ATCC 13525) and Escherichia coli FDA strain Seattle 1946 (ATCC 25922) were obtained from the American Type Culture Collection.

Techniques: Bacteria

Journal: Infection and Immunity

Article Title: Prolonged Impact of Antibiotics on Intestinal Microbial Ecology and Susceptibility to Enteric Salmonella Infection

doi: 10.1128/iai.00006-09

Figure Lengend Snippet: FIG. 3. Incomplete recovery of the intestinal microbiome after antibiotic treatment. Parallel groups of mice (n 5 mice per group) were given untreated drinking water or bacitracin-streptomycin in drinking water for 1 week. The antibiotics were withdrawn, and the biome was allowed to recover for 1, 3, 7, 14, or 21 days. Total bacterial genomic DNA was isolated from the DSI, cecum, and LI of each mouse. qPCR was performed to quantify numbers of total bacteria (A), the E. rectale-C. coccoides group (Erec) (B), the Enterobacteriaceae (Ent) (C), and SFB (D) per gram. * indicates statistically significant differences from control mice (P 0.001).

Article Snippet: 16S rRNA gene group-specific and kingdom-specific primers for qPCR Group Reference strain Primer Sequence (5 –3 ) Temp (°C)at last step Reference Eubacteria (All bacteria) Ruminococcus productus UniF340 ACTCCTACGGGAGGCAGCAGT 63 1 (ATCC 27340D) UniR514 ATTACCGCGGCTGCTGGC 63 Eubacterium rectale-Clostridium R. productus (ATCC UniF338 ACTCCTACGGGAGGCAGC 60 13 coccoides 27340D) C.cocR491 GCTTCTTTAGTCAGGTACCGTCAT 60 Lactobacillius/Lactococcus Lactobacillus acidophilus LabF362 AGCAGTAGGGAATCTTCCA 56 33 (ATCC 4357D) LabR677 CACCGCTACACATGGAG 56 Bacteroides Bacteroides fragilis BactF285 GGTTCTGAGAGGAGGTCCC 61 11 (ATCC 25285D) UniR338 GCTGCCTCCCGTAGGAGT 61 MIB MIB plasmid CT11-6 Uni516F CCAGCAGCCGCGGTAATA 58 35 MIBR677 CGCATTCCGCATACTTCTC 58 SFB SFB plasmid CTL5-6 SFB736F GACGCTGAGGCATGAGAGCAT 58 37 SFB844R GACGGCACGGATTGTTATTCA 58 Salmonella enterica serovar S. Typhimurium (ATCC Sal454 TGTTGTGGTTAATAACCGCA 56 24 Typhimurium 700720-D) Uni785R GACTACCAGGGTATCTAATCC 56 3 Enterobacteriaceae E. coli (ATCC 10798D) 515F GTGCCAGCMGCCGCGGTAA 67 23 826R GCCTCAAGGGCACAACCTCCAAG 67 on M arch 15, 2015 by guest http://iai.asm .org/ D ow nloaded from dance in the DSI, the most prominent bacterial group present in the cecum and LI is the E. rectale-C. coccoides group.

Techniques: Isolation, Bacteria, Control

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Enzymes used for generating standards.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques:

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Observed sizes versus expected sizes for XmnI digests. Expected versus observed lengths of XmnI-cut E. coli stationary phase DNA. The expected length of XmnI fragments prepared using PacBio library method 2.1 derived from the E. coli genome sequence is plotted on the X-axis versus the mean ( A ) or median ( B ) size of observed fragments from stationary phase DNA. The mean and median for the same DNA prepared using the Oxford Nanopore ligation method ( C and D ) and the transposase method ( E and F ) are also shown.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques: Derivative Assay, Sequencing, Ligation

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Coverage of long fragments. The relative coverage of individual DNA fragments is shown for E. coli (blue) and lambda (orange). Each line represents an individual PvuII fragment from either E. coli (blue) or lambda (orange). With PvuII, there were no lambda fragments with a size of 10–15 kb while the 30 such E. coli fragments are each shown individually in blue. Coverage across the length of each fragment is normalized to the maximum for the given DNA and then plotted versus the normalized length. The dip in coverage in the middle of the fragments is most extreme for long E. coli fragments.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques:

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Ratio of normalized reads in exponential vs. stationary phase E. coli genomes. Reads from three digests were normalized within the exponential and stationary phase DNA samples. The ratio of exponential/stationary phase reads for each fragment as a function of genomic position is shown in panel ( A ). The results from all three digests were then combined and the ratios averaged over bins of 100,000 bp as shown in panel ( B ).

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques:

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Oxford Nanopore reads using the transposon-based fast library preparation. XmnI-cut E. coli DNA was prepared for sequencing using the standard fast library preparation method. The number of RPM is plotted as a function of predicted DNA length ( A ). The same data set was converted to RKPM to adjust for length and plotted again ( B ) but on a log scale.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques: Sequencing

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Read frequency as a function of length and 3’ terminal bases with Oxford Nanopore ligation-based library preparation. The average read count ( A ) and coefficient of variation ( B ) were calculated for all XmnI E. coli fragments from 400 to 10,000 bp. Length bins were selected to provide enough examples in each bin for all terminal base combinations. All points included > 5 fragments except for the 4001–5000 bp bin with CC termini which was omitted from the plots. All fragments with the same pair of 3’ ends were combined for analysis.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques: Ligation

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Fitting of DNA length versus read frequency. The read frequency of DNA fragments was fit using linear regression and cubic spline regression with E. coli DNA read counts as a data source ( A ). E. coli and lambda DNAs were mixed, cut with PvuII, and prepared using the 2.1 PacBio protocol. Because the linear regression methods did not model the E. coli DNA well, only cubic smoothing spline regression was used for lambda DNA. Lambda DNA was then used as the data source ( B ) and the spline regression generated with lambda data only was compared to the experimentally observed data for E. coli lengths and read counts. The darker blue line provides the best fit for both the modelled lambda and the experimental E. coli data.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques: Lambda DNA Preparation, Generated

Journal: Scientific Reports

Article Title: DNA read count calibration for single-molecule, long-read sequencing

doi: 10.1038/s41598-022-21606-5

Figure Lengend Snippet: Fragment Analyzer Relative Lengths with GQN10 cutoff.

Article Snippet: E. coli genomic DNA purchased from ATCC and DNA purified from exponential phase cells was of similar size while DNA from stationary phase cells was smaller, possibly due to degraded DNA from dead cells (Table ).

Techniques:

Journal: mSphere

Article Title: Genome-Based Targeted Sequencing as a Reproducible Microbial Community Profiling Assay

doi: 10.1128/mSphere.01325-20

Figure Lengend Snippet: Use of control samples to establish thresholds for defining MAG presence. Thresholds for declaring a MAG present in a sample were determined using Escherichia coli genomic DNA, ZymoBIOMICS Microbial Community Standard, and a no-template control (NTC). (a) The number of probes present for each MAG ( y axis) and the MAG abundance ( x axis) for each control sample before applied thresholds are shown in gray. Blue (Allegro) and green (JAX) points indicate MAGs detected in each control sample when considering only probes with ≥0.001% abundance. (b) The percent relative abundance of each MAG in each sample based on the Allegro design ( x axis) and the JAX design ( y axis) is shown. MAGs with 10 or more probes above the 0.001% probe-abundance threshold in both designs are shown in blue. Pearson correlation of the two designs is R = 0.98. (c) The number of probes per MAG detected using the Allegro design ( x axis) and JAX design ( y axis). As in panel b, MAGs with at least 10 probes with ≥0.001% abundance in both assays are colored blue. Most MAGs have ≥10 probes per MAG above the threshold (top right) or ≤5 (bottom left). (d) The number of MAGs detected per sample with minimum probe abundance and probe representation (probes per MAG [ppM]) thresholds is shown compared to the number of MAGs detected with no thresholds across mouse samples. (e) Percentage of reads that map to MAGs with and without the probe representation thresholds.

Article Snippet: A no-template control (NTC), Escherichia coli gDNA (ATCC 8739), a human stool metagenome DNA sample , and a defined composition microbial community control (ZymoBIOMICS Microbial Community Standard, catalog no. D6300) were used as controls.

Techniques: Control